Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666685
Length 598 bp
Fasta Format > whkp8d02
tgggcatggacgcctccgccctggcctacggcgacatcgtcaagagggtc ctccggtgctttggcccttcagagttctctgcggcggtcaccatctttgg tggccgcggccacgccgccacctggggcaagaagctcgacgccgaggcat acgactgcaacaacgttgtggagcaggagctcccctgtggaggcgtcctc atctaccagagctttaccgtgaacgaagaggttgctgtctctgccgggtc gcccaggtccgtcttccactgcttcgaggccgagagtgtgcacagccacc ctctggtcaaggaaggcaagctcgccaacctcctcgcatggcgggcggag gaggattctctggaagagggcgcggtgctgtgcgagtgaagacatgattt gctgtcgctattccatctgtggaatttgttctgactgtcagtttgtcgtt tggttactgtgaagcagccggccaggctattgctctctgaataaactatt anctctaggtggtttgctgcgtctgccacaatgagcgtacttctggggaa aagctgtctcgaacttataaataagcattatttttcctaaaaaaaaaa
Download
page-top