Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666558
Length 632 bp
Fasta Format > whkp7l16
atgtatgactggataatacttctcctccttgctgtcntanatggactgtt gaatataattgagccttttcaccgcttcattgngaaggacatgatgactg acttgagatatccattanagggcaatactgtgcccttttgggctgttccg ctcattggaattgtcttgccatgtgtcatctttggtggaatttacttcaa gaagaagaatatctatgatttgcaccatggcatactgggtattctttatt cggtgctcataactgcggtgattactgatgcaattaaggatggagttggc cgaccacgtcctgatttcttctggcgctgtttcccagatggaaaggatct ttatgataatgtcactactggcgttctgtgccatggagagaagagtgtca tcaaagaaggtcacaagagcttcccaagtggacactcatcatggtctttc gccggcctaggcttccttacatggtacttgactgggaaaatcgcagtttt tgaccgtaaaggtcatattgcaaagctgtgcattattgttctgcctctac ttactgctgcacttgttgctgtttctcnagtggatgactactggcatcac tggcaanatgtggttgcanganctgttctang
Download
page-top