Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666551
Length 347 bp
Fasta Format > whkp7l07
cctgacgcctatgtccgcgtcatcggcttcgacaacctgcgccaggtgca gtgcgtcagcttcatcgccttcaggccaccgggttgcgaggagtctggca aggcctaaactacgagttgaaacaatggcctatgtatgaaggtcttttgt gaacttaacttttgtccaccactctgctggacgaccagagcatatttttc attctatatggtctgtgtgtgtatgtacgaacataggttctcgagcatgc atatgtaaattctagaaccggctacacatatacaaaacctgtgtgatatt tattatatacaaacacgcggaccattgtcttgctgttaaaaaaaaaa
Download
page-top