Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666511
Length 699 bp
Fasta Format > whkp7j04
aatctagcccatctcaccatctccagctgagctcaacaccactactactg caaactcaatagggatggctcgcggtgcagctactcagctcgtgctggtg gccatggtggccgctatgctcctcgtagcctgcgatgcggcgatatcctg cggtcaggtgacctctgccttgagcccctgcatctcctatgcacgcggca atgtcgccaacccgcctgcggcctgctgcagcggcgtcaggagtctggcc ggtgcagcccggagcaccgccgacaagcaagcagcgtgcaagtgcatcaa gagcgctgctggtgggctcaacgctggcaaggccgccggcatcccttcaa agtgcggcgtcagcgtcccctacgccatcagctcatctgtggactgttct aagattcgttgatcgaccacttcttctcatcatcgctgcatatagctcca gcgatctacgctgagtacgattgaggtcatacacatacatatacatatat atgaataagtgctctcatattatctcactgcgtgacagcgagaggagtac ctacgtccggccagctctgcatggcaggccacactgttgtattgatgttt ggttgttccttcacccttttgagaggactcatgagtttgttcttctttgt accgtgtgcactttcgatatatggatcttacactagtagaaaaaaaaaa
Download
page-top