Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666487
Length 715 bp
Fasta Format > whkp7h23
atcgggtcggggaggatgacgacgggagggcgcgcggtgctcctgctgcc gctgctggtggtctcggcgctgttcgcccagatccgcgcgtcggatccgc tgttccacgagtccttcgacgagggcttcgaggggagctgggtcgtctcc ggcaaggaagagtactcaggtgtatggaagcacgagaagagtgatgggca tgaagactatggtctccttgttagtgagccagccaggaaatatgccatag tcaaagagcttgatagccctgttactttgaaggatggcacagttgttctg cagttcgaagtgaggcttcagaatggcctcgagtgtggaggtgcttatct taagtacattcgccctcaggaggctggatgggatgccaaggaatttgaca atgacactccttacacaattatgtttggtcctgacaagtgtggttcaacg aataaggttcacttcatcctgaagcacaagaaccccaagactggcaaata tgttgaacatcacctcaagtccccaccctctgtcccatatgacaagctct ctcatgtctacacggctatcttgaagccggataacgaggtcagaattttg gttgatggggaggagaagagcaaagcaaacttcctttccgctgatgattt tgagccagcacttattccatcaaagactattcctgaccctgacgacaana agccanaggactggg
Download
page-top