Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666297
Length 844 bp
Fasta Format > whkp6m08
cgccgcaggctttgaccccatcgcccctccgtcctcttcgtctccggtag gccaggtagttaacagctccagcagccatgggaaaggagaagatccacat cagcattgtggtcattggccatgtcgactctggcaagtcaaccacgactg gccacctcatctacaagcttggaggcattgacaagcgtgtgattgagagg tttgagaaggaagccgctgagatgaacaagaggtctttcaagtatgcctg ggtgcttgacaagctcaaggctgagcgtgagaggggtatcaccattgata ttgctctgtggaaattcgagaccaccaagtactcctgcactgtcattgat gctcctggtcaccgtgatttcatcaagaacatgatcaccgggacctccca ggctgattgtgctgtgcttatcattgactccaccactggtggttttgagg ctggtatctccaaggatggccagacccgtgagcacgctctccttgctttc actcttggtgtgaagcagatgatctgctgctgcaacaagatggatgccac cactcccaagtactcgaaggcccgttatgaagaaattgtcaaggaagtct cttcatacctgaagaaggttggttacaaccctgacaaggttccctttgtt cccatctctgggttcgagggtgacaacatgattgagaggtccaccaacct tgactggtacaagggccccacccttctcgaggccctggaccagatcaatg agcccaagaggccctcagacaagcccctccgtcttccccttcaggacgtg tacaagattggcggcattggaactgtgccagtgggccgtgttga
Download
page-top