Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666290
Length 810 bp
Fasta Format > whkp6l23
ctactctcagaagattgtgatcaagacctgtgggactaccatgctcctgc tcaccattcctaggattcttgagcttgctgaagagctgtgcatgccgctt gctgccgtgaagtactctcgtgggatgttcatcttccccggcgcacagcc tgctccccacaggagcttctctgaggaggttgatgtcctgaaccgctact tcggccacctgaagtctggcggcaatgcttatgtgatcggagacccagcg aagcctggccagaagtggcacatctactatgccaccgagcaacctgagca gcccatggtcaccctggagatgtgcatgactgggctggacaagaagaagg cctctgtcttcttcaagactcaagctgatagccacgtttcctgcgccaag gagatgaccaagctctctggtatctccgacatcattcccgagatggaggt ctgtgacttcgacttcgagccctgcggctactccatgaacgccatcaacg gatctgccgtctccaccatccatgtgacccccgaggacggcttcagctat gcgagctacgaggtcatgggcatggacgcctccgccctggcctacggcga catcgtcaagagggtcctccggtgctttggcccttcagagttctctgcgg cggtcaccatctttggtggccgcggccacgccgccacctggggcaagaag ctcgacgccgaggcatacgactgcaacaacgttgtggagcaggagctccc ctgtggaggcgtcctcatctaccanagctttaccgtgaacnaanaggttg ctgtctctgc
Download
page-top