Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ665900
Length 776 bp
Fasta Format > whkp5e18
ctcttcgtctccggtaggccaggtagttaacagctccagcagccatggga aaggagaagatccacatcagcattgtggtcattggccatgtcgactctgg caagtcaaccacgactggccacctcatctacaagcttggaggcattgaca agcgtgtgattgagaggtttgagaaggaagccgctgagatgaacaagagg tctttcaagtatgcctgggtgcttgacaagctcaaggctgagcgtgagag gggtatcaccattgatattgctctgtggaaattcgagaccaccaagtact cctgcactgtcattgatgctcctggtcaccgtgatttcatcaagaacatg atcaccgggacctcccaggctgattgtgctgtgcttatcattgactccac cactggtggttttgaggctggtatctccaaggatggccagacccgtgagc acgctctccttgctttcactcttggtgtgaagcagatgatctgctgctgc aacaagatggatgccaccactcccaagtactcgaaggcccgttatgaaga aattgtcaaggaagtctcttcatacctgaagaaggttggttacaaccctg acaaggttccctttgttcccatctctgggttcgagggtgacaacatgatt gagaggtccaccaaccttgactggtacaagggccccacccttctcgaggc cctggaccagatcaatgagcccaagaggccctcagacaagcccctccgtc ttccccttcaggacgtgtacaagatt
Download
page-top