Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ665828
Length 728 bp
Fasta Format > whkp5a13
gagaatgggctggtgcccattgttgagcctgagatccttgttgatggacc tcatgacattgaccgctgtgcttacgtgactgagatggtccttgctgcgt gctacaaggccctcaacgaccagcatgtcctccttgagggcaccctcctg aagcccaacatggtcacccctggatccgacgccaagaaggtggcccctga ggtgattgctgagtacaccgtccgcaccctccagaggactgtccctgctg ccgtcccagccattgtcttcctctctggtggacagagcgaggaggaggcg accctgaacctgaacgccatgaacaagctcgagaccaagaagccatggaa cctgtccttctccttcgggcgtgccctccagcagagcaccctcaaggcct gggctggcaaggtggagaacgaggagaaggccaggaaggcgttcctggtg aggtgcaaggccaactctgaggccaccctcggcacctacaagggcgatgc caccctcggcgagggggcctctgagagcctccacgtcaaggactacaagt actgatctgccttcggtgcggtggcctgtttgggtgtcctgcttaccagt attatcgtttggttttcagagtcttgatatatccttcggatatcgaacct agtatggaacttgtgctctcaaaatagcttaggtagtttcgtttttggag tccgaataccctgttactcgggtgctgc
Download
page-top