Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ665439
Length 708 bp
Fasta Format > whkp3j17
ggcgtatgaggattgcattggcaagggcgctgttcatgaacccgaccatc cttttgcttgatgagccaaccaaccatcttgatctcgaggcttgtgtctg gctggaagagaaattaaagaattttgagcgtatacttgttgttatctcgc attcccaagattttctaaatggagtgtgcactaacatcatccacatgcag aacaagaccctcaagttatatactggaaattatgaccagtatgttcaaac tcgctctgagcttgaagagaatcaaatgaagcagtacaaatgggaacagg aacagatagctaatatgaaggagtacattgcacgatttggtcatggatct gcgaagcttgctcgtcaggctcagagcaaagagaagactcttgcaaagat ggagcgtggtggtcttgctgagaaggttgtcaatgacaggattcttgtat tccgctttacagatgttggcaaactcccaccaccagtgctgcagtttgct gatgtcacatttggttacactccggataatctcatctacaagaaccttga cttcggtgttgaccttgactcgagagttgcactggtcggtcccaatgggg ctggtaagagcacacttctgaagctcatgacaggtgacctatctccgttg gatggcatggtcagacgccacaaccacctacgcattgcacaattccatca acatctca
Download
page-top