Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ665304
Length 565 bp
Fasta Format > whkp3b24
gctcaagtgggtgccctgcctcgagttcagcaaggttggcttcgtcttcc gtgagcacaacagctcccccgggtactacgacggccgatactggacaatg tggaagctgcctatgttcgggtgcactgacgccacacaggtgctgaacga ggtggaggaggtcaagaaggagtaccctgacgcctatgtccgtgtcatcg gcttcgacaacctgcgccaggtgcagtgcgtcagcttcatcgcctttagg ccaccgggttgcgaggagtccggcaaggcctaaactacgagttgaaacaa tggcctatctcgtatgaaggtcttttgtgaacttcacttttgtccaaaac tctgctgtacgactctgctttctgaccggagcataccttttgttctatat gattttgtgtatgtatgtacgaacataggttcttgagcatgcatacgtaa ttcctcataggtctatatcttcttcttcggcacaacccccgaatacatca atggacgagatctgtctataccttttcataataaagagtaggatggtctt tcaagaaaaaaaaaa
Download
page-top