Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ665287
Length 491 bp
Fasta Format > whkp3a22
tgaaacaggtcgactacctgatccgctcaaagtgggtgncctgnctcgag ttcagcaaggttggcttcgtcttccgtgagcacaacagctcccncgggta ctactacngccgatactggacaatgtggaagctgcctatgttcgggtgca ctgacgccacacaggtgctgaacgangtggaggaggtcaagaangagtac cctgacgcctatgtccgtgtcatcggcttcnacaacctgcaccaggtgca gtgcgtcancttcatcncctttangccaccgggttgcgaggagtccggca aggcctaaactacnanttgaaacaatggcctatctcntatgaangtcttt tgtgaacttcacttttgtccaaaactctgctgtacnactctgctttctga ccggancataccttttgttctatatgattttgtgtatgtatgtacnaaca tangttcttgancatgcatacntaattcctcanaaaaaaaa
Download
page-top