Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ665165
Length 811 bp
Fasta Format > whkp2j01
cccttcaggacgtgtacaagattggcggcattggaactgtgccagtgggc cgtgttgagactggagtcatcaagccaggcatggttgtcacctttggtcc tactggcctgaccactgaggtgaagtccgttgagatgcaccatgagtctc tcctggaggcgcttcctggtgacaacgtcggcttcaacgtcaagaacgtg gctgtcaaggatctcaagcgtgggtacgtcgcttccaactccaaggacga ccctgccaaggaggctgccaacttcaccgcccaggtcatcatcatgaacc accccggccagatcagcaacggctatgccccggtgctggactgccatacg tcccacattgctgtcaagtttgctgagatccagaccaagatcgaccggcg gtctggcaaggagattgaggcggcgcccaagttcctcaagaacggtgatg ctgggttcgtcaagatgatccccaccaagcccatggtggtggagaccttt gcccagtaccctcccctgggccgctttgctgtgcgtgacatgaggcagac ggttgccgtgggtgttatcaaggctgtggagaagaaggatccgaccggtg ccaaggtgaccaaggctgcggccaagaagaaatgagatggtgtcaggttc tttactgcatctatggtggcggtggcggtatttggtggtggtgatagttg ttctanttgttttggaaacttgttaagcttcngttatttgtgtcnagcan tgttggaactgcttattgctctgtcattgtatcnttcggttgtgttggtg aaacttcntca
Download
page-top