Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664498
Length 684 bp
Fasta Format > whkp1d11
atctggggtaatcactcgtccagtcagtatcctgatgttaaccatgccac tgtgaagactcccagtggagagaagcctgttcgtgaacttgttcaagatg atgaatggctaaatggggagttcattgccactgtccagcagcgtggtgct gcaatcatcaaagcgaggaagctctccagtgctctctctgctgccagctc agcttgtgatcacatccgtgactgggttctgggaaccgctgagggaacat ttgtttccatgggtgtgtactctgatggttcatacggtgtgcctgctggt cttatctactccttcccagtaacgtgcagtggtggtgaatggacaattgt tcaagggctcccgatcgatgagttctcgaggaagaagatggatgcgaccg cccaggagctgtcanaggagaaggcgttggcctactcatgcctggcgtaa atccacattcgaagggcagctgctcctctggatgttttgaataaatgaaa ccttccgctctttagaaactctcgtctccacccagaacagccgcacatcg cgatgcatgctccttttcgctggttttccaagtgtgtatgaatgaggctt gtagctccccttttgcctgatgatttacaggacagtacatttgctgcaag agtgaaacaatttgacacctgattanaaaaaaaa
Download
page-top