Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662496
Length 715 bp
Fasta Format > whkp12o20
tctcacctacacccttgacgagatggaaggcccgctcgaggtcggcgccg acggcaccctcaagttcgaggagaaggacggcatcgactacgcggccgtc accgtgcagctccccggaggcgagcgcgtgcccttcctcttcaccgtcaa gcagctcgtcgccaccggcaagcccgagagcttcagcgggcccttcctcg tgcccagctacaggggttcgtctttcctcgacccaaagggccgtggtggc tctactggctacgacaacgccgtggcgctacccgccggaggcagaggaga cgaggaggagttggccaaggagaacgtgaagaacgcgtcctcctccacgg gcaacatcacgctcagcgtcaccaagagcaagccggagaccggcgaggtg atcggcgtcttcgagagcgtgcagccgtcagacaccgacctcggcgccaa ggcgcccaaggatgtcaagatccagggtgtgtggtacgcgcagctcgagt ctaactagagcagagcagaagtgaagatactcatcttgtgtgcatgcgta cgtgggttgatcggtggagaggaaacaatcgaggcaacaatgtgtgtttg tgtgtgtatctagtaatctaaacccanggtgtcggtttatattttanctt ctgttattgtttcttcctcncctactcatgatattgatcccccatgaatg ttcacaaaaaaaaaa
Download
page-top