Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662343
Length 615 bp
Fasta Format > whkp12g16
tcgagaccctgtcttacttgccacccctctccacggaggccctcctgaag caggtcgactacttgatccgctccaagtgggtgccctgcctcgagttcag caaggttggcttcgttttccgtgagcacaacagctcccccgggtactacg atggtcgatactggacaatgtggaagctgcctatgttcgggtgcaccgac gccacacaggtgctcaacgaggtggaggaggtcaagaaggagtaccctga cgcctatgtccgcgtcatcggcttcgacaacctgcgccaggtgcagtgcg tcagcttcatcgccttcaggccaccgggttgcgaggagtctggcaaggcc taaactacgagttgaaacaatggcctatgtatgaaggtcttttgtgaact taacttttgtccaccactctgctggacgaccagagcatatttttcattct atatggtctgtgtgtgtatgtacgaacataggttctcgagcatgcatatg taaattctagaaccggctacacatatacaaaacctgtgtgatatttatta tatacaaacacgcggaccattgtcttgctgttattaattcaggaaaagtt tctttaaaaaaaaaa
Download
page-top