Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662065
Length 807 bp
Fasta Format > whkp11g22
gagtctggcggcaatgcttatgtgatcggagacccagcgaagcctggcca gaagtggcacatctactatgccaccgagcaacctgagcagcccatggtca ccctggagatgtgcatgactgggctggacaagaagaaggcctctgtcttc ttcaagactcaagctgatagccacgtttcctgcgccaaggagatgaccaa gctctctggtatctccgacatcattcccgagatggaggtctgtgacttcg acttcgagccctgcggctactccatgaacgccatcaacggatctgccgtc tccaccatccatgtgacccccgaggacggcttcagctatgcgagctacga ggtcatgggcatggacgcctccgccctggcctacggcgacatcgtcaaga gggtcctccggtgctttggcccttcagagttctctgcggcggtcaccatc tttggtggccgcggccacgccgccacctggggcaagaagctcgacgccga ggcatacgactgcaacaacgttgtggagcaggagctcccctgtggaggcg tcctcatctaccagagctttaccgtgaacgaagaggttgctgtctctgcc gggtcgcccaggtccgtcttccactgcttcgaggccgagagtgtgcacag ccaccctctggtcaaggaaggcaagctcgccaacctcctcgcatggcggg cggaggaggattctctggaagagggcgcggtgctgtgcgagtgaagacat gatttgctgtcgctattccatctgtggaatttgttctgactgtcantttg tcntttg
Download
page-top