Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662054
Length 803 bp
Fasta Format > whkp11g06
aaatcggcagcgtttccattccattccgccagaggcagagcggcagcgcg agcgagttttggttggtggacacagacacacaagacgaacacggcggtac agatggcgtccccgtcctcgtcgctctgctccagcctcggctacccgcgc gccgcctccctcggcgcccgccgccgcgccggcttctcctcgtccaggaa gctattccaagtgaaggcatcaagggtcgacagtttctccaagagtgaca tcattgtgtccccttccattctctctgcaaacttcgccaagcttggtgaa caggtaaaagctgtggaggtggcaggatgtgactggattcatgttgatgt catggacggtcgctttgtgccaaacatcacgattggaccattgattgttg atgctctgcgtccagtgactgatcttccattggatgtgcatctgatgatt gtggaacctgagcagcgaattcctgattttatcaaggcaggtgctgatat tgttagcgtccactgtgagcaaacggcaaccatccatctgcaccgaacag tcgatcagattaaaagtctaggagcaaaggctggagttgttttgaaccct gggaccccactcagtgcgatagaatatgtacttgaatctgttgatctggt attgattatgtcagtcaaccctgggtttggtgggcaaagcttcattgaga gccaagtaaagaaaattgctgatttgagaaaattatgtgaagagaaggga gtgaacccctggattgaggttgatggtggagtcagccccaaaaatgccta caa
Download
page-top