Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661847
Length 809 bp
Fasta Format > whkp10j23
agagtgtgctgattgaaccaaccaggtggcaacacaggcattgggctggc cttcatggctgctgccaagggttacagacttgtactcacaatgcccgcct ccatgagtatggagaggagaatcatcttgaaggcctttggtgctgagctg atcctcaccgacccactcttgggaatgaaaggagctgtccaaaaggcgga agagcttgcagcaaagacgcccaactcatacatccttcagcagttcgaga atcctgccaacccaaagattcactacgagacaactgggcctgaaatctgg aaaggcacaggtggaaagatcgatggccttgtttctggcatcgggacagg tggtaccattactggaactggaaagtacctcaaagagcaaaactctaaca tcaagctctacggtgtggagcctaccgagagtgctgtcttaaatggtgga aagcctggaccacacaagatccaaggaattggagctggttttatccctgg tgtcttggatgttgacatcattgatgaaaccatacaggtttcaagtgatg agtctattgagatggcaaagtctcttgcattgaaagaaggattgctggtt gggatctcttctggtgctgctgcagctgctgcaatcaaggttgctcagag gcctgaaaatgcagggaaactctttgttgttgtgttcccgagcttcggag agcgctacctttcgtcggtgctcttccactccatcaagaaggaggccgan agcatggtggtcgagtgacgctcgggactcgtctcctcaagcgcgcgaan ctgttctcc
Download
page-top