Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661754
Length 312 bp
Fasta Format > whkp10e23
gtgtcctgctatggtagtttcggttaagcagctggccgggtgaccggcaa agcctactgtatcccgtcttactgcttttattatttttctgtcatcgttc ctgccgaataagttgctctagatggtctgctgcgtctgccatagtgagca aaagagtctgttgtggggagaatgtaataaatatttatgtctgtcgccaa tactcttatggggagaatgatattgtaactcatactacctccgtcccata atataagattgtatttgacactatgttcaatcaaatattggagttctccg ttaaaaaaaaaa
Download
page-top