Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661752
Length 412 bp
Fasta Format > whkp10e21
aaaaaaaagaatcattctctcaagaggtaggtcgaactgatcaagtctat aagagtccaacctctcccagcaggaagctcgattaccaggaagcactaac acaaggcagaatgatagatatttttggtcttgtaccagcaagacgcttgt tgggcgatgataatttcagtctttaccacttggtcttgccggccatatat taaaaatgatctgtatgtttcatgtagtcaagtactcaaatgcttgctga gcactgataaattcagtccttaatttgttctacttccagtttgacatgta cgtgtggtcctacttgcctcttgtgatgtgttctcatgtactcaagtact gaaatgcttgctgaacatcgataatttcaatccttaaattgctatatttt ccaaaaaaaaaa
Download
page-top