Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661749
Length 365 bp
Fasta Format > whkp10e16
cgagcttagcaaaaagggtgtgacaactatcattggaggcggagactccg ttgcggctgttgagaaggtgggagtggctgatgttatgagccacatctca actggtggtggcgccagcttggagttgttggaaggaaaggagcttcctgg agtcgttgcacttgatgaaggtgtcatgacgaggtcggtgaccgtatgag gctaagcttcatttgttgcatcttaattcctttcatgtaccgttccaaac ctgccatgttgtcctccctcttttgctcgtcttcgaccactcgaaatgta agagaccaatgttttatagagaaatactgggaactgtttgaataacaccc ccagcaaaaaaaaaa
Download
page-top