Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661748
Length 655 bp
Fasta Format > whkp10e15
gcctgcctcatctctcggagcaggaggaggagcttgcaggaacaatggca gcccagggtcttctctctgggaggcagctgctggggaggcctctgcagtc ctccatctccaggtcgtcttcctcccggaagtcccccttcgtcgtcaggg catcgtccagcccccctgccaagcaaaatgacaacaggcagctgtggttc gcgtccaagcagtccctcacctacctcgacggcacgctgcccggtgactt tggtttcgaccccttggggctgtccgacccggagggcaccggcgggttca tcgagcccaggtggctggcctacggcgagatcttcaacggccggacggcg atgatgggggtggtgggcatgatcgccccggaggccctgggcaaggtggg cctggtgcccccgganacngcnatcccgtggttccangcangcncgatcc cnccggcgggcacctaccantactgggccnacccatacacnctcttcntg ttcnanatggnnctcatcnnnttcncnnancaccnnnnnntccangactg ntacaacccnnnctccatgnnnaannannacttcctgnnncttnanaant anctcnnnnnntccnnnnanncnnnctanncnnnnnnnnnnatnttnann nnnnt
Download
page-top