Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661745
Length 800 bp
Fasta Format > whkp10e12
gtcatcctggccagccatctgggccgcccaaaaggtgtcacccccaagtt cagcttgaagcctcttgttccacgcctgtctgagctccttggacttgaag ttgtgatggcccctgactgcattggtgaagaagttgagaaattggctgct gctttgccagatggcggtgttctactcctggagaatgtgagattctacaa ggaggaagagaagaatgatcctgagtttgctaagaagcttgcatcggttg ctgacctttacgtaaatgatgctttcggcactgcacatagggctcatgct tcaaccgagggtgtaaccaagtttttgaggccttctgttgctggcttcct catgcagaaggaacttgactatcttgtcggagctgttgccaacccaaaga agccatttgctgccattgttggtggatccaaggtctcatctaagattggt gtgatcgagtctctgctggccaaggttgatatcctcatccttggtggtgg tatgatcttcacattctacaaggcccagggattacctgttgggaagtccc ttgtggaggaagacaaacttgaactggcaacttcactgattgaaacggca aagtccaagggtgttaagctcttgctaccgacagatgttgttgtggctga caagtttgcagcagatgctgaaagcaagattgttcctgccactgctatcc ctgatggttggatgggtctggatgttggtccanattccatcaagactttc ncanaagccttggacaccaccaagactgttatctgggaacnggtcctatg
Download
page-top