Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661744
Length 810 bp
Fasta Format > whkp10e11
gcttaggccatgggcgacccaattcttttcagaatgagtgagttaaaagc ccgaccagcagcttgcggaagtgctcgattgtatcttactgagctacaaa agattgttaagaactgggatacaagcaaaccatggcttccaaaaaagaga gtagatgaggtcgtaagtgaagcagataaactgaaaacttggttggagga gaaggaagccctacagaagagcacccctgtccacagctcgcctgctttca catctgaagaggtctaccagaaagttttagccctacaaaataaggtctct agcgtcaataggatcccaaaaccaaaacccaaggttgagaagaaacccgc aaaggaggaagctaacaaggagaagacggactcttcagaatctgcatcca gcgagtctgaatccacggagaagccgtcggaatcagatgcccctgagaag aataacgattcggaaccagaatcccatgacgagttgtgattattagaatc ggcttttgaacacccctgagagatactactcaaaatatactccgagaaga tagctcgtcaccaccacagttttgtttggcggccgaaaagacagagaggt ttgtgtaggaattcacggcaggctagatgctatacgagcgagaagaattt gatattgatcgctgtatagcaatattgtggtctctagggcatatgctgtc gagatagcggctcgaaaggcttagttgtcaggactgagaagactttgtag ctgcattgttgtactgaaactcatttatattttgataacagctactatag aaaaaaaaaa
Download
page-top