Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661743
Length 847 bp
Fasta Format > whkp10e09
agttgcttattctgtcctgtctgcacacactgagagcaatatgggtggca aggttcttctgatgagtgccgtcttggtggggcttgtttcactgagctcg tgcaggagcctgggagagttgcatgagcagaagacccactatgggggctc atcaactcccacgcatgggtcaggaggaggctacaacccgacactgacac cgacaccaacttacggcactacaccgacgccatcttacggcactacaccg acaccaacttacggcattacaccgacgccaacttacggcactacaccgac gccatcttacggcactacaccgacgccatcttatggcactacaccgagca ccccaagtgcaccttcccatgatgtccctgcaagtccaaagaagcatggg ttcattggatcctgcgactactggaagaatcacccagatgctatagttgc agctattgggtccctcggcaacatcggcaagacatttggtgctgcatgca gtatgataggtggcaagaagctaggaaatatgcatgatgcactctcaaac actagaactgatggtattggcgccctgatacgtgagggggcagctgcata cctcaactccattgtgaacaagaagttcccatttaccacccagcaggtga aggactgtatcgtcgtggccgtgacctctgatggtgctgcttctgcccaa gctggggttttcaagaaggcaaatgaattccactactagtttcagtcatc ggtgtttcttggctaaatttcttcctcccgcgcatttttcttgattgatg ctatcttgtggcttgatatatttcttttatttttgtngttttatcat
Download
page-top