Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661742
Length 725 bp
Fasta Format > whkp10e08
ctgagctcgcaggcagccccagccaccagcgaaatggccgcgtcggcgct gcaccagacgaccagcttcctcggcaccgccccgcggngtgatgacctcg tccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtc aagagcgcgccccagagcatctggtacggccctgaccgtcccaagtacct gggcccgttctccgagcanaccccgtcgtacctgaccggcgagttccccg gcgactacgggtgggacaccgccggattgtcggctgacccanagaccttc nccaagaaccgggagctggaggtgatccactcacggtgggcgatgctcgg cgccctggggtgcgtgttcccggagatcctgtccaagaacggcatcaagt tcggcgaggccgtgtggttcaaggccggtgcccagatcttctccgagggc ggcctcgactacctgggcaaccccaacctggtgcacgcgcagagcatcct cgccatctgggcggttcaggtggtgctcatgggcttcatcnagggttacc gcgttggtggcggccccctcngcgagggcctcnacatcatctacccangc ggcnccttcnacccacttgncctcnccnacnaccccnacaccncanctga nctcaangtcaanganctcaanaacnnncncctcnccatgttctccatgt tcngnttcttcntncangncatcnt
Download
page-top