Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661740
Length 805 bp
Fasta Format > whkp10e06
agacgttcgacctgctggaggcgccaagaagttctctgctgcatactcga actgcgcgaagaagccatcctgatatcgtttttggcatccccttcccgta gtttaggatttttatgcaattttattctgactcttttctcccaccaatct ctctggcctgcttcacgataatcgaccagttctctagtcttactccctct gttcctctctgctctgctttctgactcaaactgcaacaatggctgccccg acctctgcaatcgggttcgagggctacgagaagcgcctcgagatcacctt ctccgaggcatcgatctttgccgaccctcatggtcgtggcctgcgcgccc tctctagggcccagattgactctgttcttgatcttgcacggtgcaccatt gtgtccgagctctccaacaaggacttcgactcgtatgtgctatctgagtc cagcctgttcatctattctcagaagattgtgatcaagacctgtgggacta ccatgctcctgctcaccattcctaggattcttgagcttgctgaagagctg tgcatgccgcttgctgccgtcaagtactctcgtgggatgttcatcttccc cggcgcacagcctgctccccacaggagcttctctgaggaggttgatgtcc tgaaccgctacttcggccacctgaagtctggtggcaatgcttatgtgatc ggagacccagcgaagcctggccagaagtggcacatctactatgccaccga gcaacctgagcagcccatggtcaccctggagatgtgcatgactgggctgg acaag
Download
page-top