Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661739
Length 508 bp
Fasta Format > whkp10e05
cgccgcatcctccttgggcatcccccagcgaaccgagaaccgcgatgggc cagcctgcctgaagaatgggtgtccggcggacggaggagcgtataccgac cgcggatgcctcaagaagtacggctgctcgttaacgccaccacagtccac agtgaactgaagggcactacgtacgggcgtcaatgcaacctccttcctgc acgccgtccgttcatgggcgcactcgcgttccatccatccatccatgttt tatttcctttccattttgcatttcagtatcgtcgttgctaacttttctgt cggcatgtacgtaccttgaaatgacttggtattccgtactacgtagagtt ggcatgattgtgcaagcgacacggttgtaccatccggctgatggtcgata ctatagttgatgttatcttacgtccagtttgcacttaaacacaagtaaaa acaatttgtacatctccttggaataagatctcactgcatttggattccaa aaaaaaaa
Download
page-top