Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661733
Length 588 bp
Fasta Format > whkp10d23
aaagaagagagttgctgaagagaagaaatcagcgaggaggatggggctcg gagtacgccttctgccaccctccgcagaggatgctgccgctgcagctcgt gtgaggttcgcctcgaatttcgagaagaacaggaaggacaagagagcagc gatcaaggccgcctccatcttcccggagccatcaggctcagcttcgaaag acaagctagaccttgcgctgaagaggcggaatataaaagctagtgcagcg tcggcgctgatggcgggcagggcaaagccgtcgtcgtggtcgcggcagag caccggttctggaagtgcaaggactgctgtgccgatattggcaaggcgca agtagagccacaccccgagttgtgcttgcgcaaccaagcaagaattttgt gatcttgtccggtctgttgctcagtacgccccatgtatacgtgtatcttg tgtagtaccttcattgatctagcagtgtactgtaaccttggtgttatgtc ctgctgtcgtggctggggctgtgagcctgtgacatatcatgagaaactga tttgccttgtaactgatgattctggactaaaaaaaaaa
Download
page-top