Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661727
Length 854 bp
Fasta Format > whkp10d15
gacgagagagattggttgcgctcgtcacaatctggcctaagtgatgctcg tgacttagcttcgaggagccggctccaatctcggtgtcctctctcactgt ccctgaatcctacagcttcaattgtggccatccgttgcggatgatggtgc tcgcagccgcagcgagcgcaccgtccctccaaggttggaaacgccagatc tcagctgttacctgccagcatccacattcagtcccactcccacgcactgt gttcagagtatctgcaacaaagaataatgagaggaaacggagacgctccc ggaatctgtccaaaggcccagcattaatcgccgaagaagcttccccgagc aacggcgaaaaccccaccaccatccttgatctcaatgtcgatgatgatgc tactagcgatgagaaagctgcgggtgccccaaggagtgctgttcttcagt cttgcaccctcacatccggcttgctgcttgcattaggtctccttcttcgt gaggcatcacacgttgcatcttcaaatggactgccgtttgctgaccctac ggccgtatcattcaattttgaaacctggcatctcgagttggtcgccggac tagtaatattgatatcgtctaccagatacattctgctacagatatggccc gatttcagagattccagtgaagccgcaaatacacagatccttacttccct ggagtctctggattacattgtagttgcttgtctccctgggataagtgaag agttcctgtttcgaggggcattgatgccaatttttggattgaattggata agtgctctagcaactggtgtctttttcggtgttcttcacttgggaaatgg cagg
Download
page-top