Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661726
Length 868 bp
Fasta Format > whkp10d13
gctcacccgagacaaccgggagtagagagcttcggacgaggagatggcct gctggttgggggcagcctgcagagtggcggcagcgggggtcttgcggtct gagcggcaacgactcagccttcctctagcactgacggcggcaaagagggc cagcgtcttggagcagcaacgagaggaagcagccggcagcgctcgcgctg tccaagggtgtgtggcgagcccaactactactaaggtgacagataaccaa atggagagtgaagtcgcaatgggctacacgatgacccaaatctgtgatag gtttattgagttcttcatgcatgagaagccagaaacaaaggactggagaa aagtattggttttcagagaggagtggcaaagatacagaccacacttctac aagcactgccaagtgtgtatagatgtggaaactgatacttctgtgaagca aaagttgattgtactcgctagaaaagtaaagaagatcgatgatgaaatag agacgcacatggaactcttcacagagctcagagagaatcccactgatatc aacgctattgttgcgagacgacgaaaggatttcactggggacttcttccg caatcttaattttcttgtaaatgcttacaatggccttgatgagcgagatg caattgccaggcttggggccaagtgtctatctgcaattcatgcatatgat tgcacactgcagcagttggacattgattctgctcaatcaaaatttgatga tatattgaattcttcttcactagatgatgcctgtgacaagataaaaggat tanctaaggctaaagaacttgactcatctttanttcttctgattaatana gcctgggctgctgcaaaa
Download
page-top