Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661725
Length 763 bp
Fasta Format > whkp10d12
ggatcttcctttcagtcccaggtgattcttttgagctaagtcgggaggga ggccccatacctttttatgtcattataaaacaagatcgttcgtctctaag gagagcatgaatacttgatttgagtacnagaagaaataaacagctgcagg ggggaccgaagaggagaaagaaggacaaagaaaaaggaagggagagggaa aacaagaaggctgaacaagaactagcgtaatcagtcattgattcacctac gtgctgagcatgtgtcctcaatttttagtccatgagcccacgatttaacc gcctccaagcattgattcacaactcaactcaggtgggatggccatgttgt caaagacttgcctatttcaagccagccatatagtccaacggcaaatggta acctttccatgctgttattttttgcttacaaaatggattgctccaggtgt caaagacgtcagacgtttcttaactgtttacccccaagatatttggattc tctttagtttggntgaactgcaaagcaaattgcgccgttgtttcctaatc tgcaccgctgaagtgacatgcattgtcggccataattatttgttttttca gcagaactgaacaaacatcaggcctttttctgaccaacaaccagccaaag aattctccttttcttgggtctctaggtgatttttcctttgtggatttgtg ttcccaatggagtcagttttaatacatcacatttatattccagaggaaat tggttaaaaaana
Download
page-top