Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661724
Length 784 bp
Fasta Format > whkp10d11
gcatcccgggtcgtgaagtgtggatcttcctttcagtcccaggtgattct tttgagctaagtcgggagggaggcccctacctttttatgtcattataaaa caagatcgttcgtctctaaggagagcatgaatacttgatttgagtacaag aagaaataaacagctgcaggggggaccgaagaggagaaagaaggacaaag aaaaaggaagggagagggaaaacaagaaggctgaacaagaactagcgtaa tcagtcattgattcacctacgtgctgagcatgtgtcctcaatttttagtc catgagcccacgatttaaccgcctccaagcattgattcacaactcaactc aggtgggatggccatgttgtcaaagacttgcctatttcaagccagccata tagtccaacggcaaatggtaacctttccatgctgttattttttgcttaca aaatggattgctccaggtgtcaaagacgtcagacgtttcttaactgttta cccccaagatatttggattctctttagtttggttgaactgcaaagcaaat tgcgccgttgtttcctaatctgcaccgctgaagtgacatgcattgtcggc cataattatttgttttttcagcagaactgaacaaacatcaggcctttttc tgaccaacaaccagccaaagaattctccttttcttgggtctctaggtgat ttttcctttgtggatttgtgttcccaatggagtcagttttaatacatcac atttatattcagaggaaattggttaaaaaaaaaa
Download
page-top