Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661722
Length 543 bp
Fasta Format > whkp10d09
tatctcattgctagcccctgtcatgggtgcagaaataacatgccaaaagc tgctccctgttgtcattaattcctcgaaggacagagtgccgaacatcaaa ttcaatgttgcgaaagttctgcagtcgcttgtaccaatccttgatcaatc tgtcgctgagaagactgtgaagccatgccttgtcgagctgagcgaggacc ctgatgtggatgtacgatactatgcaaaccaggcccttcaggcgtgtgac cagatcatgatgtctagctaactaagctactgtcgtcacgttctttagaa gctattcttagtccagcttggagtacatgtaatttacccttaagagtccg agagttctttctagcccagtaacttacctatacttccatgctgataatgg atgggctatgttccccttttgttgttattaatattgtataattgagcaac gagacacgttgtttcgatggtgtgcttaaattgatagtttgaacttgatt tctgtcattccatgtgttgggtgtgattttaccaaaaaaaaaa
Download
page-top