Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661721
Length 691 bp
Fasta Format > whkp10d08
gtcagattgtacgagaggaaggcccctcggagctttaccgtggtctgacg ccgagtctgataggagtggtgccatacgccgcgaccaactactatgccta cgacaccctgaggaagctctacaggaagacattcaagcaggaggagatca gcaaccttgcaaccctcctgattggttcggccgcgggcgccatctcgagc actgccaccttccctctcgaagtagctcggaagcaaatgcaggctggggc ggtgggtggaaggcaggtctacaagaacgtgttccatgccctctactgca taatggagaaggaagggatgggcggcctgtacaaggggctcgggcccagc tgcatcaagctcatgcccgcggcggggatctcgttcatgtgctacgaggc atgcaagaagattctggtcgaagccgaggagtagagcgaagtgcgccgcc agggtcgggtccttaaagaagaggcggcaggaggattaagcctcgtcttt ctttctatcaagaaaagaaaattggatgatcaactactcatcagaagctt aggtcaaaggtatttgagacacgtctgttanatgaagaagttttggcctc taaattanttctgtgttcgagttgaaatccataaacaatattctgactgg cggaagcagttttgtcatgctactttgcttcaaaaaaaaaa
Download
page-top