Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661717
Length 460 bp
Fasta Format > whkp10d04
gatgatacttatagtctccaggtgcttccattgactccatcacagtgccg gtgttgaaggacctccacgatctaagagtgttggagcctacgatgcctcc tgtgcctgcccaattaacagtgttccaccatacaccatagagtgccttcc tcaacattaccttgttaagaatgttccatcatacatccataccatagtgt ccatccataacatacatgccacccacgtgcataccccttcctccgtatac acttgcatgccatctatatgagttaatttagagttttttttcaaataaaa gtctaatttccctggttattgtcgaccgccactttgtctcccgtggaatt aggtttagttttccttgttccaaaacattttattcgagtgtgttggtgat gtatgtgtaaggtatgtaatgctggtgtttagcatgcgatatgtttaatt aaaaaaaaaa
Download
page-top