Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661716
Length 461 bp
Fasta Format > whkp10d03
gcagatgatacttatagtctccaggtgcttccattgctccatcacagtgc cggtgttgaaggacctccacgtctaagagtgttggagcctacgatgcctc ctgtgcctgcccaattaacagtgttccaccatacaccatagagtgccttc ctcaacattaccttgttaagaatgttccatcatacatccataccatagtg tccatccataacatacatgccacccacgtgcataccccttcctccgtata cacttgcatgccatctatatgagttaatttagagttttttttcaaataaa agtctaatttccctggttattgtcgaccgccactttgtctcccgtggaat taggtttagttttccttgttccaaaacattttattcgagtgtgttggtga tgtatgtgtaaggtatgtaatgctggtgtttagcatgcgatatgtttaat taaaaaaaaaa
Download
page-top