Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661711
Length 817 bp
Fasta Format > whkp10c22
cagcctgaacctgctctgccctttaatccattggctgctagagccgctac cataagcctatcagcatttggaccattcgggtttaacttctttaatggca agggcaaaaagcagaacaagaagcccaacaatctcgaccagtcacagaag aagcccaacaagccagatcagaattccatgaaacaaaaaggaggcaaccc accgtcccacgaggcaatgagtgatgaatggctagaaaatggacagtgcc cactagctcggtcttaccgggcaatgagtggtgttctgccccttgttgcc aaggcactacagccaccagctggtatgaagctgaagtgcccgcctgcaat tgttgctgcacgagcggcccttgcacgcacaaccctcgtgaagtccctcc gtccgcagcccctgcctgcaaagatggtagccatcgcaatgctcgggatg gcagcgaacgtccctctaggggtgtggcgcgagcacaccaagaaattctc tccccagtggttcgctgccgtgcacgccgccgttccgttcatcgcgatgc tgaggaagtctgtcaacatgcccaggaccgcgatggtgttcaccatagca gcctccatcctcgggcagaccatcgggtcgagggctgagcgcatccgcct gaagactctggctgcaaagggcactgccggccccaccaccgcagtcactg tcatgtatccagataanagcggcagctgcancgacgccgagggcaaggcg tgggatcctcttgcgctgaagatgcctggctctgctaacgcangcgctcc tgcacctacccctanca
Download
page-top