Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661704
Length 409 bp
Fasta Format > whkp10c14
agggcgcggcggccgctgcaaaacccggggcgcgagcccgggcggagcgg ccgtcggtgcagatcttggtggtagtagcaaatattcaaatgagaacttt gaaggccgaagaggagaaaggttccatgtgaacggcacttgcacatgggt aagccgatcctaagggacggggtaaccccggcagatagcgcgatcacgcg catcccccgaaagggaatcgggttaagatttcccgagccgggatgtggcg gttgacggcgacgttaggaagtccggagacgccggcgggggcctcgggaa gagttatcttttctgcttaacggcctgccaaccctggaaacggttcagcc ggaggtagggtccagtggccggaagagcaccgcacgttataaaggaaaga aaaaaaaaa
Download
page-top