Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661703
Length 658 bp
Fasta Format > whkp10c13
tacggccggcagggccgggcagggcacactccgttatccaatccggcgtc cgtgcacgcagcgcacaccatgtaggccacaagatctcagatagcttatg tcatggtggtggcataagctaccagtaccagctgcatgcctgtgctcttc ttcaattggaggcttggagtgtgccctgggccggccatggcccatgggcg cgtacgtagcagccgatggatccggcgttggctagctatctctggcctac atcaagctgcagctggctaggctacttgggttcttgaggaagctcggggt gaaacggccatggctggccggcagggcggcctcgtccacggcggcggcgg cgacttctcacctctactaaggtagggcaacttctatcctttggcaattg taacttctcgatcggggagcgtgatgatctctctcctgtgagtaccggtg acgatcatagcatggtgcgagtcttcagtgtcgtgtaactactagtagct agctataccaaattgatatgaagctagctagtggtagctagtatgggtgt gtgtgtatgatcctgcttgaatccttcnattctgctatctatgggcagtg tatttgttgagttttgtatctggtaatatctcttttgttaaccccngcaa aaaaaaaa
Download
page-top