Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661700
Length 792 bp
Fasta Format > whkp10c10
tcacccgccgccgcttctcctcctccggaagaaaaacagagagcttcaag ttctccggagcgagagagatggcggcgaagggcgatgggccggcgatcgg catcgacctcggcacgacgtactcgtgcgtcggcgtgtggcagcacgaca gggtcgaaatcattgccaatgaccagggcaaccgcaccacgccgtcgtac gtggccttcaccgactccgagcgcctcatcggcgacgctgccaagaacca ggtggcgatgaaccccatcaacaccgtcttcgatgccaagcgtctcattg gccggagatttaccgattcaactgtccagagtgacattaagctgtggccc ttcaaggttgttgctggacctggtgacaagcctatgattaatgtccagta caagggtgaggagaagcagtttgcagctgaggagatatcctctatggtcc tcatcaagatgcgtgagattgcagaagctttccttggcagcactgtgaag aatgctgttgtcactgtacctgcatacttcaatgactcgcagaggcaggc taccaaggatgctggtgtcattgctggcatcaatgtccttcgtatcatca acgagccaacagctgctgccattgcttatggtcttgacaagaaggcttcc agtgttggtgagaagaatgtcctcatctttgatcttggaggtggtacctt tgatgtctctcttctcaccattgaggagggcatctttgaggttaaagcca cagctggtgacactcatcttggtggtgaggactttgataaca
Download
page-top