Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661697
Length 810 bp
Fasta Format > whkp10c07
ctcgcatccgcatcgcaccgcaattgtcttccttcctcgacggacgcacg cacgcagatctcatccaaggcaggtacaagatggctctcaccagaattgg tcttgctggcctcgccgtcatggggcagaaccttgccctcaacattgcag agaaaggcttccccatctctgtctacaacaggaccacctccaaggtcgat gagactgtccagcgcgccaagctagaaggaaaccttcccctgtacggttt ccatgaccctgcatccttcgtcaactccattcagaagccacgcgtcgtca tcatgcttgtcaaggctggcgcaccagttgaccagaccatcgccacgctc gcagcacacctggagcagggcgactgcatcgttgatggaggaaacgagtg gtatgagaacacagaaaggagggagaaggcgatggaggagcgtggactcc tctacctcgggatgggtgtttccggaggagaggagggtgcccgccatggc ccctccatgatgcctggaggctcgctggaggcgtaccagtacattgaaga cattcttctcaaggtgtctgctcaggtccctgacagcggcccgtgtgtca catacattgggaagggtggatccggaaactttgtcaagatggttcacaat ggtattgagtacggtgacatgcanctgatcgctgaggcgtatgacgttct caagtcggttggcaagctcacaaacggtgagctgcancangttttcaccg agtggaacaanggtganctcctcantttcttggtcnanatcactgctgat atattcanca
Download
page-top