Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661696
Length 587 bp
Fasta Format > whkp10c06
tagccggcaccatgggttacatcgcgccggagtaccaccagtcgctcaag ttcacggccaagtgcgacatctacagcttcggggtgatcctggcggtgct ggcgacggggaaggagccgacggaccagttcttcgtgacggaggtggagg aggtcgggctggtcaagtggctgcgccgggtggtgcagaacggcgactac gcggaggccatcgaccccgccatcgccggcgccgggcacgaggagcagat cctgctggtgctgcgcatcgccgtgttctgcaccgccgacgaacccaagg agcggcccgaggccaaggacgtgcgctgcatgctcgcccagatcaagaac tagtagtctagtcaccgtataggcgcgagccaaagctccgtgtaagtatt ggtcgtcgtcgtcgtcttcaattgggcatgtgtcatgcgtgactgtgtgt anaataatgctgcaagtgctgggtcancgggtcaagtatggggccggtcn atcnataaanaccggaaaggaggcccgaccattttacacaaatgatattt anaatganattgcntatatttttttctaaaaaaaaaa
Download
page-top