Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661692
Length 622 bp
Fasta Format > whkp10c02
agcccccaagggtctcaccgccggcgtacaagccagcccccaaggtctca ccaccggcgtacaagcccgcccccaaggtctcaccgccggcgtacaagcc agcccccaaggtctcaccgccggcgtacaagcccgcccccaaggtctcac ctccggcgtacaagcctgtccccaagccctcaccgccgccgtcgccaact ccgccggcgccgaagccgactccaccgccctacaagcccccgacgcctac tcctccggcgtacaagcctcccaccccgagccccccgcctccgccgtacc accactaagaagatccaccactgtcaagctgggagcctaggatgcggtcg agaagagttgtgcgagcaggccaagaagagccacgtacgtacggcgtcgt tgatcctcctgcggtgtgtgagttgctgccgagctactagggccgatctc tgaggagatggaataatgcagatggctcccattagttatcttaccagctt atcatttgtgttcgtccagtgttagcgtctgtgttgctagtgtcgcaatg ttgccagtgtcactgtaaaaccattaatcaccacggaaatggaagttaaa ggtgttgtttccaaaaaaaaaa
Download
page-top