Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661688
Length 613 bp
Fasta Format > whkp10b22
cggggtcgtcaagganaagctcaagatcatccccaaagatcacgagtggc acgagctgtcggaccccgtctacaacgcgctggtcaacgacttcatgaan ccacggatcgacgaggtcgacgagctgctgtcttacggcgtagatgtcac ggnttataatggccagctggatgtgatttgctcgaccaacggcgcggaan catgggtgcaaaagctcaaatgggatgggctgaanaacttcctgagcctg ccgaggcagcctctgtcctgcggatcatccaaggtcaccaaggccttcgt cagatcctacaagaacctgcatttctactggatcctcggcgccggccact tcgtgccggccgaccagccttgcatggcactgagcatgatcgctggcata acccantctccagncagctangggaggaggacccggancanatcctgtct gccggataggaaaaggaaactgaagatagaagtatagaaagaaaggttgc gtgtactttaaagggcgatgaaattgattgtaaggtgcgttggtgtgtga gtggggttaaagctcgtccgttttattctccgaataaagatgacgccttt tataaaanaaaaa
Download
page-top