Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661684
Length 528 bp
Fasta Format > whkp10b14
gactgagatctgcaagccctgcgttggttccctcaacgaggaggatgtgg cgccacaagaagccgaatggggcatgatggacgctcttgccaagaggtct tcagttaaggcgatcttcgtggggcacaaccacgggctcgactggtgctg cccgtacgagaaactgtggctgtgtttcgcgcggcacacgggtcacggcg gatatggtgactggccaagaggggcaaggatcgttgagatagccgagaag ccgttctctgtccactcctggatacggatggagaaccggagcacgcacag ccatattacattgtcttgagcttgattcggataggattcagaatcgtctg caccatgatgtgttgagttcggaaagtccaccaatatgcaaacagtttgc aactttgtatttgattcagttaggctttggtgcaggtggctccaacgaat aattttgagtttggctcatgttagtgtcgttatatcacagtatgaactaa aattacgacacttattgtaaaaaaaaaa
Download
page-top