Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661683
Length 516 bp
Fasta Format > whkp10b12
tcacacctccaattagcaaatattctccatgcaaatgagctatccaggcg ttttcaggaagaaggatgtgatctgactgcaaattcgctgcaccctggaa tcatcggaaccaacatcgttcgctacatcacgacaaacagtgtgctggcc tcgattttctcgctggtcaagccttttgtgaaggatataccccagggagc tgcaactacctgttatgtggcattgcatcctgataccaggggtgtgtccg gcaaatacttcgctggttgcaacgaggcgacgccgacctccgttgcaaga gatgcagagctggccaagaggctgtgggcgtttagtgaagaacttgtaga aaatagatcaaagtgatgcgatgcggtgtgctgtgattgtgtgcagcggc gacgcataactccgccactgattgtttgtatatatgcatgtactgatcga agagggtatgtctacctacctactgtaaactgccaaaaaaaaatccgtga atacggaaaaaaaaaa
Download
page-top