Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661680
Length 778 bp
Fasta Format > whkp10b08
tttcctccgcttcgctctcgcagtggttgtaggttgtgacattttgctgc ttgtttcggtgcagaatgcctcgctacgatgagcgtgatcgttacggtgg caacacaaggctgtacgtgggtcgtcttccctcgcgcacccgcacaaggg acctcgaagacctcttcggcagatatgggagagtgcgacatgtggatatg aagcacgagtttgcatttgttgagtttagtgatcccagggatgctgatga agcaaggtacaatcttgatggtcgtgactttgatggaagccgcatgattg ttgagtttgctaaaggggttccgcgtggccaaggaggaggaggtgaccgt gaccgtggtggccgtggtggtgaccgtgaatatatgggtcggggacctcc tcctggttctgggcgttgctttaactgtgggattgatgggcattgggctc gggactgcaaagctggcgactggaaaaacaggtgctatcgttgtggagat agtggccacatagaaagggattgtcanaacagccctaanaacctcaagcg tggaaagagttactccanatctccatctcctcnccgcggaagggtgcgtg atangagctacancangagccgcantangagctacagccgctctgtttcc ccaaggagggatgaaaggcnatcaagganccctcncnacantcncanccc aangangancccccntgacantctcanccccangangancccccncaaca ntcncanccctatnaanancccccntgg
Download
page-top