Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ661679
Length 220 bp
Fasta Format > whkp10b07
ggtctggcaggagatacggaaactaaggaggactggatcagacgactacc tgaagtaccatgatcgtcctgaccttcctcatgggcttgttttcgacgca catggcagggcagagctgttttctcctgcacagtttggtgtattgtagag ctgtcgtttcgtgaacctctgtatgggttttcagtgtttaatagaggttt ggtttgtgttaaaaaaaaaa
Download
page-top